Detail of EST/Unigene DW015416 |
Acc. | DW015416 |
Internal Acc. | EST1224377 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | N-carbamoylputrescine amidase OS=Solanum tuberosum E-value=0; N-carbamoylputrescine amidase OS=Solanum lycopersicum E-value=0; N-carbamoylputrescine amidase OS=Arabidopsis thaliana E-value=0; N-carbamoylputrescine amidase OS=Oryza sativa subsp. japonica E-value=0; Omega-amidase NIT2-B OS=Xenopus laevis E-value=1e-16; |
Length | 833 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GAAAGAAAGATGTTGTACGCAACACGCACACCCAGAGCATAAAGTGTTTTTTCAGAAAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01431 beta-ureidopropionase; Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K01431 beta-ureidopropionase; Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K01431 beta-ureidopropionase |
EC | 3.5.1.6 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817290 |
Trichome-related Gene from Literature | N/A |