Detail of EST/Unigene DW015928 |
Acc. | DW015928 |
Internal Acc. | EST1224889 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | UPF0160 protein MYG1, mitochondrial OS=Bos taurus E-value=2e-51; UPF0160 protein MYG1, mitochondrial OS=Rattus norvegicus E-value=7e-51; UPF0160 protein MYG1, mitochondrial OS=Mus musculus E-value=1e-50; UPF0160 protein MYG1, mitochondrial OS=Homo sapiens E-value=1e-50; UPF0160 protein C27H6.8 OS=Caenorhabditis elegans E-value=4e-46; |
Length | 849 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GAAAGCCTACAAAATAATTGTTAAAAAACTAGAGGAGAGATTTTAGGTATGAATGTGAGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834202 |
Trichome-related Gene from Literature | N/A |