Detail of EST/Unigene DW015941 |
Acc. | DW015941 |
Internal Acc. | EST1224902 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hexokinase-2, chloroplastic OS=Nicotiana tabacum E-value=1e-77; Hexokinase-4, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-75; Hexokinase-like 1 protein OS=Arabidopsis thaliana E-value=6e-67; Hexokinase-1 OS=Arabidopsis thaliana E-value=1e-63; Hexokinase-9 OS=Oryza sativa subsp. japonica E-value=4e-62; |
Length | 755 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GAAAAACAAGAAAGGAGAAGATCCCTCTCCAAATAAACACAGAAGAAGAAAACATGTCTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00521 Streptomycin biosynthesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00530 Aminosugars metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00844 hexokinase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K00844 hexokinase |
EC | 2.7.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841200 |
Trichome-related Gene from Literature | N/A |