| Detail of EST/Unigene DW016020 |
| Acc. | DW016020 |
| Internal Acc. | EST1224981 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Calcium-dependent protein kinase OS=Daucus carota E-value=0; Calcium-dependent protein kinase 9 OS=Arabidopsis thaliana E-value=0; Calcium-dependent protein kinase 21 OS=Arabidopsis thaliana E-value=0; Calcium-dependent protein kinase isoform 2 OS=Oryza sativa subsp. japonica E-value=0; Calcium-dependent protein kinase 33 OS=Arabidopsis thaliana E-value=0; |
| Length | 793 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | GGCGTTCTAATTTCAATCATCTTTCAATCCAAATCACAATAATGGGTTGTCACGGCAGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II |
| EC | 2.7.11.17 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821586 |
| Trichome-related Gene from Literature | N/A |