| Detail of EST/Unigene DW016157 |
| Acc. | DW016157 |
| Internal Acc. | EST1225118 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | UPF0160 protein MYG1, mitochondrial OS=Bos taurus E-value=1e-50; UPF0160 protein MYG1, mitochondrial OS=Rattus norvegicus E-value=3e-50; UPF0160 protein MYG1, mitochondrial OS=Mus musculus E-value=5e-50; UPF0160 protein MYG1, mitochondrial OS=Homo sapiens E-value=5e-50; UPF0160 protein C27H6.8 OS=Caenorhabditis elegans E-value=3e-45; |
| Length | 680 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | AGAAGCACTTCACTCTTCAACTTCGTCTAATGTCTAACGCTAAAACAGCTAGGGTTTCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834202 |
| Trichome-related Gene from Literature | N/A |