Detail of EST/Unigene DW016290 |
Acc. | DW016290 |
Internal Acc. | EST1225251 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 54S ribosomal protein L12, mitochondrial OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-09; 54S ribosomal protein L12, mitochondrial OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=1e-08; 39S ribosomal protein L12, mitochondrial OS=Mus musculus E-value=2e-07; 39S ribosomal protein L12, mitochondrial OS=Homo sapiens E-value=1e-06; 39S ribosomal protein L12, mitochondrial OS=Cricetus cricetus E-value=2e-06; |
Length | 732 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GGAGTGTTTCATTTTCGAAATCTTCCCCACCGCCCGCCGCCACATCTCCCCGTCTCAGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843355 |
Trichome-related Gene from Literature | N/A |