| Detail of EST/Unigene DW016384 |
| Acc. | DW016384 |
| Internal Acc. | EST1225345 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protein tumorous imaginal discs, mitochondrial OS=Drosophila virilis E-value=8e-12; DnaJ homolog subfamily A member 3, mitochondrial OS=Mus musculus E-value=1e-11; DnaJ homolog subfamily A member 3, mitochondrial OS=Homo sapiens E-value=1e-11; Chaperone protein DnaJ OS=Carboxydothermus hydrogenoformans (strain Z-2901 / DSM 6008) E-value=5e-11; Protein tumorous imaginal discs, mitochondrial OS=Drosophila melanogaster E-value=3e-10; |
| Length | 710 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | AAAAATTCTAAAAATAAAATAATTCCATCCATCAAAATATCAACCTCCATTTTTATATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | MYB |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818875 |
| Trichome-related Gene from Literature | N/A |