Detail of EST/Unigene DW016578 |
Acc. | DW016578 |
Internal Acc. | EST1225539 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Vigna radiata var. radiata E-value=3e-83; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=3e-78; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Brassica napus E-value=1e-74; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=5e-73; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=5e-73; |
Length | 766 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | AATTCATCAACATCTAGGTTTGTACTCATCTCACAACTAGCTATATTATTCCCCTTATTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |