Detail of EST/Unigene DW016621 |
Acc. | DW016621 |
Internal Acc. | EST1225582 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=3e-32; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-31; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=5e-31; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=4e-30; 30S ribosomal protein 2, chloroplastic OS=Spinacia oleracea E-value=1e-29; |
Length | 753 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | TCATTGTTTTCATCTTCCATCAACACTGTCAAATGTCTACGTTCCAAAAACTCCTCATTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842294 |
Trichome-related Gene from Literature | N/A |