| Detail of EST/Unigene DW016761 |
| Acc. | DW016761 |
| Internal Acc. | EST1225722 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic OS=Phaseolus vulgaris E-value=9e-23; NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic OS=Glycine max E-value=5e-22; NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic OS=Vicia faba E-value=2e-21; NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic OS=Lotus japonicus E-value=4e-21; NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic OS=Cicer arietinum E-value=4e-21; |
| Length | 406 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | GATTTTGACTTTGTACTTTCCAATATTGGAACGATTGTGCAAAGATTCAGAACAATTAAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |