Detail of EST/Unigene DW016761 |
Acc. | DW016761 |
Internal Acc. | EST1225722 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic OS=Phaseolus vulgaris E-value=9e-23; NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic OS=Glycine max E-value=5e-22; NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic OS=Vicia faba E-value=2e-21; NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic OS=Lotus japonicus E-value=4e-21; NAD(P)H-quinone oxidoreductase subunit 5, chloroplastic OS=Cicer arietinum E-value=4e-21; |
Length | 406 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GATTTTGACTTTGTACTTTCCAATATTGGAACGATTGTGCAAAGATTCAGAACAATTAAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |