Detail of EST/Unigene DW016980 |
Acc. | DW016980 |
Internal Acc. | EST1225941 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 50S ribosomal protein L9, chloroplastic OS=Pisum sativum E-value=7e-64; 50S ribosomal protein L9, chloroplastic OS=Arabidopsis thaliana E-value=6e-51; 50S ribosomal protein L9, chloroplastic OS=Ipomoea trifida E-value=9e-48; 50S ribosomal protein L9, chloroplastic OS=Triticum aestivum E-value=2e-42; 50S ribosomal protein L9 OS=Cyanothece sp. (strain PCC 7425 / ATCC 29141) E-value=4e-23; |
Length | 600 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | ATCATCATCAACATTATCTTCACTTCCATTGCAACATAGTTTCACCTCTAACTTGAACAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823623 |
Trichome-related Gene from Literature | N/A |