Detail of EST/Unigene DW016997 |
Acc. | DW016997 |
Internal Acc. | EST1225958 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribosomal protein S3, mitochondrial OS=Arabidopsis thaliana E-value=0; Ribosomal protein S3, mitochondrial OS=Brassica napus E-value=0; Ribosomal protein S3, mitochondrial OS=Petunia hybrida E-value=2e-74; Ribosomal protein S3, mitochondrial OS=Zea mays E-value=3e-72; Ribosomal protein S3, mitochondrial OS=Oenothera berteriana E-value=1e-71; |
Length | 807 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GAAGAATCTTTCTAAATTACTTCGGGTCAGCGGGGCGCATCCGAAATACGCCGGGGCTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |