Detail of EST/Unigene DW017184 |
Acc. | DW017184 |
Internal Acc. | EST1226145 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S8, chloroplastic OS=Glycine max E-value=1e-26; 30S ribosomal protein S8, chloroplastic OS=Lotus japonicus E-value=5e-26; 30S ribosomal protein S8, chloroplastic OS=Phaseolus angularis E-value=7e-26; 30S ribosomal protein S8, chloroplastic OS=Populus trichocarpa E-value=9e-26; 30S ribosomal protein S8, chloroplastic OS=Populus alba E-value=9e-26; |
Length | 661 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | ACTTTTTTAAATTTAAAAAGGATCAGTACACCTGGTCTACGAATCTATTCTAACTATCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |