Detail of EST/Unigene DW017190 |
Acc. | DW017190 |
Internal Acc. | EST1226151 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=3e-88; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=1e-85; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=7e-41; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=1e-26; Probable beta-1,3-galactosyltransferase 8 OS=Arabidopsis thaliana E-value=3e-26; |
Length | 769 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | TATCACTGTAGCAGTAACAGAGAGTTGAGGATTTGCATAAATATCAATTGGAATCGTGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829344 |
Trichome-related Gene from Literature | N/A |