| Detail of EST/Unigene DW017190 |
| Acc. | DW017190 |
| Internal Acc. | EST1226151 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=3e-88; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=1e-85; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=7e-41; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=1e-26; Probable beta-1,3-galactosyltransferase 8 OS=Arabidopsis thaliana E-value=3e-26; |
| Length | 769 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | TATCACTGTAGCAGTAACAGAGAGTTGAGGATTTGCATAAATATCAATTGGAATCGTGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829344 |
| Trichome-related Gene from Literature | N/A |