| Detail of EST/Unigene DW017271 |
| Acc. | DW017271 |
| Internal Acc. | EST1226232 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Calcineurin subunit B OS=Naegleria gruberi E-value=2e-27; Calcineurin subunit B type 1 OS=Dictyostelium discoideum E-value=2e-24; Calcineurin subunit B OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) E-value=2e-22; Calcineurin subunit B type 2 OS=Dictyostelium discoideum E-value=1e-19; Calcineurin subunit B OS=Cryptococcus neoformans var. neoformans serotype D (strain JEC21 / ATCC MYA-565) E-value=6e-19; |
| Length | 779 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | GTAGCCTTGTAGGTGATTGATCGATGGGTAACACATCTTCCATGCTCACACAGTACGACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K06268 protein phosphatase 3, regulatory subunit; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K06268 protein phosphatase 3, regulatory subunit |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821372 |
| Trichome-related Gene from Literature | N/A |