Detail of EST/Unigene DW017331 |
Acc. | DW017331 |
Internal Acc. | EST1226292 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Pleckstrin homology domain-containing protein 1 OS=Arabidopsis thaliana E-value=7e-56; PH domain-containing protein DDB_G0274775 OS=Dictyostelium discoideum E-value=2e-12; Cytohesin-3 OS=Mus musculus E-value=2e-11; Cytohesin-2 OS=Chlorocebus aethiops E-value=3e-10; Cytohesin-1 OS=Rattus norvegicus E-value=3e-10; |
Length | 704 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GAATCCAGCAAAGCAATGCGATGCAACTTGTTTCCTTCATAGCAAACTGAGTTGTAATTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04456 RAC serine/threonine-protein kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04456 RAC serine/threonine-protein kinase |
EC | 2.7.11.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830455 |
Trichome-related Gene from Literature | N/A |