Detail of EST/Unigene DW017398 |
Acc. | DW017398 |
Internal Acc. | EST1226359 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=4e-30; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=4e-29; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=7e-29; Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=6e-28; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=8e-27; |
Length | 595 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GTTTCCTCAAATCCCACACTACCACTTAATAGAAGCTACTGAGGCAGCTAAGCCAGTTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830441 |
Trichome-related Gene from Literature | N/A |