Detail of EST/Unigene DW017690 |
Acc. | DW017690 |
Internal Acc. | EST1226651 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastocyanin, chloroplastic OS=Pisum sativum E-value=2e-63; Plastocyanin, chloroplastic OS=Solanum lycopersicum E-value=6e-50; Plastocyanin, chloroplastic OS=Spinacia oleracea E-value=3e-49; Plastocyanin, chloroplastic OS=Silene pratensis E-value=4e-49; Plastocyanin A, chloroplastic OS=Populus nigra E-value=1e-47; |
Length | 565 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | ACCGTTACTTCCACCACCGTTGCTATTCCATCATTCACAGGCCTTAAGGCAAACGCAAGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838622 |
Trichome-related Gene from Literature | N/A |