Detail of EST/Unigene DW017836 |
Acc. | DW017836 |
Internal Acc. | EST1226797 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=2e-53; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=9e-52; Thioredoxin M5, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-48; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=5e-47; Thioredoxin M-type, chloroplastic OS=Triticum aestivum E-value=6e-45; |
Length | 663 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GAAAACCAAACAAATTAAAAACCACCAAAACACTAGAAGCTTATCCACAAGTGCTGAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820775 |
Trichome-related Gene from Literature | N/A |