Detail of EST/Unigene DW017857 |
Acc. | DW017857 |
Internal Acc. | EST1226818 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=6e-65; Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=7e-63; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=4e-50; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=2e-47; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=2e-32; |
Length | 768 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | TTTGTGATTTATTAATTGATTATAAGCTTTTTGAAGTTGATAGTTAAGTAAAAAAAGTTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.1.52 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 814696 |
Trichome-related Gene from Literature | N/A |