| Detail of EST/Unigene DW017857 |
| Acc. | DW017857 |
| Internal Acc. | EST1226818 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=6e-65; Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=7e-63; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=4e-50; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=2e-47; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=2e-32; |
| Length | 768 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | TTTGTGATTTATTAATTGATTATAAGCTTTTTGAAGTTGATAGTTAAGTAAAAAAAGTTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.6.1.52 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 814696 |
| Trichome-related Gene from Literature | N/A |