| Detail of EST/Unigene DW017867 |
| Acc. | DW017867 |
| Internal Acc. | EST1226828 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Spermidine synthase 2 OS=Pisum sativum E-value=3e-91; Spermidine synthase 1 OS=Pisum sativum E-value=8e-75; Spermidine synthase 2 OS=Arabidopsis thaliana E-value=7e-72; Spermidine synthase OS=Solanum lycopersicum E-value=1e-69; Spermidine synthase 1 OS=Arabidopsis thaliana E-value=5e-69; |
| Length | 795 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | ATTAAAACCAATCAAAACCCACCTCACATTTCTCAAAATCGAATCCATCAAAAGCAGATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00797 spermidine synthase; Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00797 spermidine synthase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00797 spermidine synthase |
| EC | 2.5.1.16 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843367 |
| Trichome-related Gene from Literature | N/A |