Detail of EST/Unigene DW017879 |
Acc. | DW017879 |
Internal Acc. | EST1226840 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M3, chloroplastic OS=Arabidopsis thaliana E-value=2e-34; Thioredoxin M3, chloroplastic OS=Oryza sativa subsp. japonica E-value=7e-24; Thioredoxin M-type, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-22; Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=6e-22; Thioredoxin M2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-21; |
Length | 739 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | TTCCTCAACTTCCCTTTCTCTCACTTCTTCCTCTCACCTTCACATACCCACATTCTCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816050 |
Trichome-related Gene from Literature | N/A |