| Detail of EST/Unigene DW018214 |
| Acc. | DW018214 |
| Internal Acc. | EST1227175 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=8e-08; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=8e-08; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=4e-07; Cysteine synthase, mitochondrial OS=Arabidopsis thaliana E-value=5e-07; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=2e-06; |
| Length | 150 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | TCCTGGAAAGACTGTTCTTGTTGAGCCAACAAGTGGTAACACTGGCATAGGATTGGCGTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 2.5.1.47 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825145 |
| Trichome-related Gene from Literature | N/A |