Detail of EST/Unigene DW018320 |
Acc. | DW018320 |
Internal Acc. | EST1227281 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-45; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=2e-44; Glucan endo-1,3-beta-glucosidase 2 OS=Arabidopsis thaliana E-value=3e-44; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=1e-43; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Nicotiana plumbaginifolia E-value=6e-43; |
Length | 781 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GAACACACTCAAACTCACACTCACACTCATTCCATATCCCACCATGCATTGTATACTCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815130 |
Trichome-related Gene from Literature | N/A |