Detail of EST/Unigene DW018329 |
Acc. | DW018329 |
Internal Acc. | EST1227290 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Peroxiredoxin Q, chloroplastic (Fragment) OS=Sedum lineare E-value=3e-77; Peroxiredoxin Q, chloroplastic OS=Populus jackii E-value=7e-77; Peroxiredoxin Q, chloroplastic OS=Suaeda salsa E-value=3e-75; Peroxiredoxin Q, chloroplastic OS=Gentiana triflora E-value=1e-74; Peroxiredoxin Q, chloroplastic OS=Arabidopsis thaliana E-value=3e-74; |
Length | 834 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | ACAACACAACACAACATGTTATCACTTTGTTCTTCCTCATCCATGGCTAAGGCTTCCCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.11.1.15 1.11.1.7 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |