Detail of EST/Unigene DW018425 |
Acc. | DW018425 |
Internal Acc. | EST1227386 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoenolpyruvate carboxylase kinase 1 OS=Arabidopsis thaliana E-value=2e-75; Phosphoenolpyruvate carboxylase kinase 2 OS=Arabidopsis thaliana E-value=7e-75; Calcium-dependent protein kinase OS=Daucus carota E-value=3e-46; Calcium-dependent protein kinase 7 OS=Arabidopsis thaliana E-value=3e-46; Calcium-dependent protein kinase 20 OS=Arabidopsis thaliana E-value=1e-45; |
Length | 768 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | AGATGTGCGAAACCCTAAAAACTAAGTACCAACTCAGCGAGGAGATCGGTCGTGGTCGTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04515 calcium/calmodulin-dependent protein kinase (CaM kinase) II |
EC | 2.7.11.17 |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837387 |
Trichome-related Gene from Literature | N/A |