| Detail of EST/Unigene DW018484 |
| Acc. | DW018484 |
| Internal Acc. | EST1227445 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 12, mitochondrial OS=Arabidopsis thaliana E-value=6e-21; Nudix hydrolase 13, mitochondrial OS=Arabidopsis thaliana E-value=2e-20; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=2e-16; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=3e-12; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=2e-11; |
| Length | 717 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | GAAAGAAGCTTTTATCCTTCATTTTTTCTCTGTTTTCCCGTGGAACCTTTTCTTCCTCTG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837845 |
| Trichome-related Gene from Literature | N/A |