Detail of EST/Unigene DW018592 |
Acc. | DW018592 |
Internal Acc. | EST1227553 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=2e-74; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=2e-37; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=7e-36; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=3e-34; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=7e-34; |
Length | 707 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | ACTGTTCAACTTTTACTTCACTTTCTTTAACTTCTTCCATTTTTGCAGACTCACAATCCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829599 |
Trichome-related Gene from Literature | N/A |