| Detail of EST/Unigene DW018724 |
| Acc. | DW018724 |
| Internal Acc. | EST1227685 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Dihydrodipicolinate synthase, chloroplastic OS=Glycine max E-value=2e-89; Dihydrodipicolinate synthase 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-84; Dihydrodipicolinate synthase, chloroplastic OS=Nicotiana tabacum E-value=1e-83; Dihydrodipicolinate synthase 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-81; Dihydrodipicolinate synthase 1, chloroplastic OS=Triticum aestivum E-value=6e-74; |
| Length | 894 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | GAGTTAGGCTCTCACATCGCCGCCAACCACCGTCTTCTCCGTCCGACCTCCGTCTTCTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819152 |
| Trichome-related Gene from Literature | N/A |