Detail of EST/Unigene DW018785 |
Acc. | DW018785 |
Internal Acc. | EST1227746 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Carbonic anhydrase, chloroplastic OS=Arabidopsis thaliana E-value=7e-21; Carbonic anhydrase, chloroplastic OS=Hordeum vulgare E-value=9e-21; Carbonic anhydrase 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-20; Carbonic anhydrase, chloroplastic OS=Spinacia oleracea E-value=2e-13; Carbonic anhydrase OS=Flaveria pringlei E-value=2e-12; |
Length | 859 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GTATTTTGTACAACTTAATTTTCCAATCAGCATTCAAGAAGTGATGGTGTGGCCAATTCG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829498 |
Trichome-related Gene from Literature | N/A |