| Detail of EST/Unigene DW018834 |
| Acc. | DW018834 |
| Internal Acc. | EST1227795 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ribosome-recycling factor, chloroplastic OS=Arabidopsis thaliana E-value=8e-67; Ribosome-recycling factor, chloroplastic (Fragment) OS=Daucus carota E-value=4e-66; Ribosome-recycling factor, chloroplastic OS=Spinacia oleracea E-value=2e-64; Ribosome-recycling factor, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-58; Ribosome-recycling factor, chloroplastic OS=Oryza sativa subsp. indica E-value=3e-58; |
| Length | 788 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | AAGAACACTAGGCGTAGAGCATCTCATGGCAACCTCTTTCTCTTCAACAACACCACTCCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825494 |
| Trichome-related Gene from Literature | N/A |