| Detail of EST/Unigene DW018846 |
| Acc. | DW018846 |
| Internal Acc. | EST1227807 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetate/butyrate--CoA ligase AAE7, peroxisomal OS=Arabidopsis thaliana E-value=0; Probable acyl-activating enzyme 2 OS=Arabidopsis thaliana E-value=6e-53; Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=1e-50; Benzoate--CoA ligase, peroxisomal OS=Arabidopsis thaliana E-value=3e-50; Probable acyl-activating enzyme 6 OS=Arabidopsis thaliana E-value=2e-49; |
| Length | 761 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | TTACACACACACGGAACGGAAGAACGCAGTGGCGATGGGTACGAAACAAGACATAGACGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
| EC | 6.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820946 |
| Trichome-related Gene from Literature | N/A |