Detail of EST/Unigene DW018940 |
Acc. | DW018940 |
Internal Acc. | EST1227901 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=8e-83; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Daucus carota E-value=3e-78; Beta-fructofuranosidase, insoluble isoenzyme 2 OS=Daucus carota E-value=8e-77; Beta-fructofuranosidase, insoluble isoenzyme CWINV2 OS=Arabidopsis thaliana E-value=2e-67; Beta-fructofuranosidase, insoluble isoenzyme CWINV4 OS=Arabidopsis thaliana E-value=2e-67; |
Length | 657 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | AGCCTTGACATGACGAGGTATGAATACTATACAGTTGGAACGTATATCCAAAATAAGGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824426 |
Trichome-related Gene from Literature | N/A |