| Detail of EST/Unigene DW018940 |
| Acc. | DW018940 |
| Internal Acc. | EST1227901 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, insoluble isoenzyme 1 OS=Daucus carota E-value=8e-83; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Daucus carota E-value=3e-78; Beta-fructofuranosidase, insoluble isoenzyme 2 OS=Daucus carota E-value=8e-77; Beta-fructofuranosidase, insoluble isoenzyme CWINV2 OS=Arabidopsis thaliana E-value=2e-67; Beta-fructofuranosidase, insoluble isoenzyme CWINV4 OS=Arabidopsis thaliana E-value=2e-67; |
| Length | 657 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | AGCCTTGACATGACGAGGTATGAATACTATACAGTTGGAACGTATATCCAAAATAAGGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824426 |
| Trichome-related Gene from Literature | N/A |