| Detail of EST/Unigene DW019020 |
| Acc. | DW019020 |
| Internal Acc. | EST1227981 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit IV A, chloroplastic OS=Nicotiana sylvestris E-value=1e-13; Photosystem I reaction center subunit IV B, chloroplastic OS=Nicotiana sylvestris E-value=8e-13; Photosystem I reaction center subunit IV A, chloroplastic OS=Arabidopsis thaliana E-value=5e-07; Photosystem I reaction center subunit IV B, chloroplastic OS=Arabidopsis thaliana E-value=3e-06; |
| Length | 277 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | GAAAGACATACAGAGAGAGAGAGAGGTATCATGGCTAGTTGCAACATGGCATCTGCAGCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828996 |
| Trichome-related Gene from Literature | N/A |