Detail of EST/Unigene DW019020 |
Acc. | DW019020 |
Internal Acc. | EST1227981 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Photosystem I reaction center subunit IV A, chloroplastic OS=Nicotiana sylvestris E-value=1e-13; Photosystem I reaction center subunit IV B, chloroplastic OS=Nicotiana sylvestris E-value=8e-13; Photosystem I reaction center subunit IV A, chloroplastic OS=Arabidopsis thaliana E-value=5e-07; Photosystem I reaction center subunit IV B, chloroplastic OS=Arabidopsis thaliana E-value=3e-06; |
Length | 277 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GAAAGACATACAGAGAGAGAGAGAGGTATCATGGCTAGTTGCAACATGGCATCTGCAGCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828996 |
Trichome-related Gene from Literature | N/A |