Detail of EST/Unigene DW019108 |
Acc. | DW019108 |
Internal Acc. | EST1228069 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | PsbP-like protein 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-51; PsbP-like protein 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-20; PsbP domain-containing protein 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-07; Oxygen-evolving enhancer protein 2, chloroplastic OS=Fritillaria agrestis E-value=1e-05; |
Length | 696 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GTGGTTACACTTTTAGCACAATGGATAAGTCAAATTCAGAAGAGTGTCCTCCAACCACAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824699 |
Trichome-related Gene from Literature | N/A |