| Detail of EST/Unigene DW019325 |
| Acc. | DW019325 |
| Internal Acc. | EST1228286 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Leucine aminopeptidase 2, chloroplastic OS=Solanum lycopersicum E-value=1e-49; Leucine aminopeptidase 1 OS=Arabidopsis thaliana E-value=3e-45; Leucine aminopeptidase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-44; Leucine aminopeptidase 3, chloroplastic OS=Arabidopsis thaliana E-value=7e-42; Leucine aminopeptidase 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-40; |
| Length | 689 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | GTTATTGCTTTCTCAAAATCTTCGTCTTCTTCTCTCTTTCTCACTTCGCGTATTCGTTTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816954 |
| Trichome-related Gene from Literature | N/A |