Detail of EST/Unigene DW019326 |
Acc. | DW019326 |
Internal Acc. | EST1228287 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic OS=Pisum sativum E-value=0; Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic OS=Nicotiana tabacum E-value=7e-78; Aldolases N-methyltransferase, chloroplastic OS=Arabidopsis thaliana E-value=6e-67; Histone-lysine N-methyltransferase setd3 OS=Gallus gallus E-value=3e-06; |
Length | 808 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | TACAATCTTTTCTGGAGGTTCAGTTTCACTCTTCCCTTTTCACACAAACAAGGGTACATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837964 |
Trichome-related Gene from Literature | N/A |