Detail of EST/Unigene DW019366 |
Acc. | DW019366 |
Internal Acc. | EST1228327 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase kinase 2 OS=Arabidopsis thaliana E-value=3e-70; Mitogen-activated protein kinase kinase 1 OS=Arabidopsis thaliana E-value=4e-66; Mitogen-activated protein kinase kinase 1 OS=Oryza sativa subsp. japonica E-value=4e-64; Mitogen-activated protein kinase kinase 6 OS=Arabidopsis thaliana E-value=2e-58; Dual specificity mitogen-activated protein kinase kinase 3 OS=Mus musculus E-value=5e-33; |
Length | 754 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | TGTAAGCAGGTTCTGAAGGGTTTAATATATCTTCACCATGAAAGACATATTATCCACAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04368 mitogen-activated protein kinase kinase 1 |
EC | 2.7.12.2 |
Transcription Factor Family | WRKY |
Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
Probeset |
|
Corresponding NCBI Gene | 829103 |
Trichome-related Gene from Literature | N/A |