Detail of EST/Unigene DW019371 |
Acc. | DW019371 |
Internal Acc. | EST1228332 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | RNA pseudourine synthase 4, mitochondrial OS=Arabidopsis thaliana E-value=6e-68; RNA pseudourine synthase 4, mitochondrial OS=Oryza sativa subsp. japonica E-value=2e-54; RNA pseudourine synthase 3, mitochondrial OS=Oryza sativa subsp. japonica E-value=5e-45; RNA pseudourine synthase 3, mitochondrial OS=Arabidopsis thaliana E-value=5e-45; Ribosomal large subunit pseudouridine synthase C OS=Rickettsia typhi (strain ATCC VR-144 / Wilmington) E-value=2e-21; |
Length | 681 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | CAAATTCAAAAGGGTAACACCTAAGGATACTTTGAACTCAGGAGATCGTATATTTCTTCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821478 |
Trichome-related Gene from Literature | N/A |