| Detail of EST/Unigene DW019371 |
| Acc. | DW019371 |
| Internal Acc. | EST1228332 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | RNA pseudourine synthase 4, mitochondrial OS=Arabidopsis thaliana E-value=6e-68; RNA pseudourine synthase 4, mitochondrial OS=Oryza sativa subsp. japonica E-value=2e-54; RNA pseudourine synthase 3, mitochondrial OS=Oryza sativa subsp. japonica E-value=5e-45; RNA pseudourine synthase 3, mitochondrial OS=Arabidopsis thaliana E-value=5e-45; Ribosomal large subunit pseudouridine synthase C OS=Rickettsia typhi (strain ATCC VR-144 / Wilmington) E-value=2e-21; |
| Length | 681 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | CAAATTCAAAAGGGTAACACCTAAGGATACTTTGAACTCAGGAGATCGTATATTTCTTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821478 |
| Trichome-related Gene from Literature | N/A |