Detail of EST/Unigene DW019441 |
Acc. | DW019441 |
Internal Acc. | EST1228402 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase-like protein 2 OS=Arabidopsis thaliana E-value=8e-25; Glucan endo-1,3-beta-glucosidase-like protein 3 OS=Arabidopsis thaliana E-value=2e-24; Glucan endo-1,3-beta-glucosidase-like protein At1g69295 OS=Arabidopsis thaliana E-value=1e-22; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=3e-15; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=3e-13; |
Length | 827 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GAAAAGCCATAAGCGGGTGAGGGAGGAAAAAAAACGCTTGTTCTCTCATCATCAATCAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838446 |
Trichome-related Gene from Literature | N/A |