| Detail of EST/Unigene DY322893 |
| Acc. | DY322893 |
| Internal Acc. | OB_EEa03H23.f |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Plastidial pyruvate kinase 2 OS=Arabidopsis thaliana E-value=2e-81; Pyruvate kinase isozyme G, chloroplastic (Fragment) OS=Ricinus communis E-value=1e-66; Plastidial pyruvate kinase 3, chloroplastic OS=Arabidopsis thaliana E-value=5e-65; Pyruvate kinase isozyme G, chloroplastic OS=Nicotiana tabacum E-value=6e-64; Plastidial pyruvate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-22; |
| Length | 742 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_EEa; |
| Sequence | CCGCATTTTAGGATATTGCTATTGCTGTTAGAGAGGGTGCCGATCCTGTTATGCTTTCAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00873 pyruvate kinase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00873 pyruvate kinase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00873 pyruvate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00873 pyruvate kinase |
| EC | 2.7.1.40 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835369 |
| Trichome-related Gene from Literature | N/A |