| Detail of EST/Unigene DY323045 |
| Acc. | DY323045 |
| Internal Acc. | OB_EEa03N01.f |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase 2 OS=Nicotiana tabacum E-value=6e-73; 4-coumarate--CoA ligase 1 OS=Nicotiana tabacum E-value=1e-72; 4-coumarate--CoA ligase OS=Vanilla planifolia E-value=6e-71; 4-coumarate--CoA ligase 2 OS=Solanum tuberosum E-value=6e-71; 4-coumarate--CoA ligase 1 OS=Solanum tuberosum E-value=6e-71; |
| Length | 692 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_EEa; |
| Sequence | CGTTTTAGAGAAATGCTCAGATGAAAATCGTGGACCCAGAACCTGTTACTTCTTTAGGCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01896 medium-chain acyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase |
| EC | 6.2.1.12 6.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841593 |
| Trichome-related Gene from Literature | 841593 |