Detail of EST/Unigene DY323338 |
Acc. | DY323338 |
Internal Acc. | OB_EEa04G13.r |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-72; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-72; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=1e-71; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=4e-71; 1-deoxy-D-xylulose-5-phosphate synthase OS=Magnetospirillum magneticum (strain AMB-1 / ATCC 700264) E-value=3e-48; |
Length | 691 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_EEa; |
Sequence | AACTCCCCCCAAACAATTTGTATTTACATTGCAATACAACATTTATATCTGGGGGGGAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K00162 pyruvate dehydrogenase E1 component subunit beta; Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K00162 pyruvate dehydrogenase E1 component subunit beta; Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K00162 pyruvate dehydrogenase E1 component subunit beta; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00162 pyruvate dehydrogenase E1 component subunit beta; Metabolism > Amino Acid Metabolism > ko00290 Valine, leucine and isoleucine biosynthesis > K00162 pyruvate dehydrogenase E1 component subunit beta; Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketo |
EC | 1.2.4.1 2.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827230 |
Trichome-related Gene from Literature | 827230 |