| Detail of EST/Unigene DY323867 |
| Acc. | DY323867 |
| Internal Acc. | OB_EEa05G09.f |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Sulfite reductase 1 [ferredoxin], chloroplastic OS=Nicotiana tabacum E-value=0; Sulfite reductase [ferredoxin], chloroplastic OS=Pisum sativum E-value=0; Sulfite reductase [ferredoxin], chloroplastic OS=Arabidopsis thaliana E-value=3e-81; Sulfite reductase [ferredoxin], chloroplastic OS=Zea mays E-value=2e-73; Sulfite reductase [ferredoxin], chloroplastic (Fragment) OS=Glycine max E-value=2e-59; |
| Length | 803 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_EEa; |
| Sequence | TTTGAATGTTCCCTTCACCCCAAACCAGAATATCATTTTGTGCGACATTCGTCATGCATG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830336 |
| Trichome-related Gene from Literature | 830336 |