Detail of EST/Unigene DY325857 |
Acc. | DY325857 |
Internal Acc. | OB_EEa08J18.f |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Trans-cinnamate 4-monooxygenase OS=Medicago sativa E-value=1e-75; Trans-cinnamate 4-monooxygenase OS=Glycyrrhiza echinata E-value=9e-75; Trans-cinnamate 4-monooxygenase OS=Glycine max E-value=6e-74; Trans-cinnamate 4-monooxygenase OS=Cicer arietinum E-value=8e-74; Trans-cinnamate 4-monooxygenase OS=Catharanthus roseus E-value=1e-73; |
Length | 712 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_EEa; |
Sequence | CCCNCTTTTTCACCAACAAGGTGGTGAACCACTACAGCCGGATGTGGGAGGAGGAGATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07438 cytochrome P450, family 27, subfamily B (25-hydroxyvitamin D3 1alpha-hydroxylase) |
EC | 1.14.13.13 1.14.99.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817599 |
Trichome-related Gene from Literature | 817599 |