| Detail of EST/Unigene DY327124 |
| Acc. | DY327124 |
| Internal Acc. | OB_MEa0001A12.r |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable 1-deoxy-D-xylulose-5-phosphate synthase 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=0; Probable 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Capsicum annuum E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase, chloroplastic OS=Arabidopsis thaliana E-value=0; 1-deoxy-D-xylulose-5-phosphate synthase OS=Nitrobacter winogradskyi (strain Nb-255 / ATCC 25391) E-value=4e-99; |
| Length | 898 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_MEa; |
| Sequence | GATCGGAGACGGAGCCATGACAGCAGGCCAGGCCTACGAGGCATTGAACAATGCAGGATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
| EC | 2.2.1.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827230 |
| Trichome-related Gene from Literature | 827230 |