Detail of EST/Unigene DY327531 |
Acc. | DY327531 |
Internal Acc. | OB_MEa0001J13.f |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Myb-related protein 308 OS=Antirrhinum majus E-value=1e-61; Transcription repressor MYB4 OS=Arabidopsis thaliana E-value=8e-57; Myb-related protein Zm38 OS=Zea mays E-value=3e-56; Myb-related protein Hv1 OS=Hordeum vulgare E-value=9e-56; Myb-related protein 330 OS=Antirrhinum majus E-value=2e-55; |
Length | 975 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_MEa; |
Sequence | GCACTTCTCCCTCACCGGACTGGTGCAGTCCTTGATTTCTCTCTCGTCGACTCCCTTGGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K01803 triosephosphate isomerase (TIM); Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01803 triosephosphate isomerase (TIM); Metabolism > Carbohydrate Metabolism > ko00031 Inositol metabolism > K01803 triosephosphate isomerase (TIM); Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01803 triosephosphate isomerase (TIM) |
EC | 5.3.1.1 |
Transcription Factor Family | MYB |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830018 |
Trichome-related Gene from Literature | 830018 |