| Detail of EST/Unigene DY328418 |
| Acc. | DY328418 |
| Internal Acc. | OB_MEa0002N03.f |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=0; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=0; Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=0; Mitogen-activated protein kinase 1 OS=Oryza sativa subsp. japonica E-value=0; Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana E-value=0; |
| Length | 904 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_MEa; |
| Sequence | GAAAGCAGAACAGTGTCAGTTTATTCATGTCTGAAGTGCATCAAATGGTAGGGATCTAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K04371 extracellular signal-regulated kinase 1/2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04371 extracellular signal-regulated kinase 1/2 |
| EC | 2.7.11.1 2.7.11.24 |
| Transcription Factor Family | WRKY |
| Transporter Classification Family | 1.A.2 Animal inward-rectifier K+ channel IRK-C; 1.A.26 Plant plasmodesmata PPD |
| Probeset |
|
| Corresponding NCBI Gene | 818982 |
| Trichome-related Gene from Literature | 818982 |