Detail of EST/Unigene DY328505 |
Acc. | DY328505 |
Internal Acc. | OB_MEa0002P02.r |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 4-coumarate--CoA ligase 1 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 2 OS=Nicotiana tabacum E-value=0; 4-coumarate--CoA ligase 1 OS=Solanum tuberosum E-value=0; 4-coumarate--CoA ligase 2 OS=Solanum tuberosum E-value=0; 4-coumarate--CoA ligase 1 OS=Petroselinum crispum E-value=0; |
Length | 800 nt |
Species | Ocimum basilicum |
Belonged EST Libraries | OB_MEa; |
Sequence | GTCTTCTCCTTCTTTGGTGCCTCCTACATCGGCGCTGTTTCCACCATGGCTAACCCCTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K01904 4-coumarate--CoA ligase; Metabolism > Lipid Metabolism > ko00120 Bile acid biosynthesis > K08748 solute carrier family 27 (fatty acid transporter), member 5 |
EC | 6.2.1.12 6.2.1.7 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
|
Corresponding NCBI Gene | 841593 |
Trichome-related Gene from Literature | 841593 |