| Detail of EST/Unigene DY328851 |
| Acc. | DY328851 |
| Internal Acc. | OB_MEa0003G13.r |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Petunia hybrida E-value=6e-84; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Arabidopsis thaliana E-value=1e-69; Aspartate aminotransferase OS=Pinus pinaster E-value=2e-69; Aspartate aminotransferase OS=Thermus aquaticus E-value=6e-37; Aspartate aminotransferase OS=Rickettsia felis (strain ATCC VR-1525 / URRWXCal2) E-value=1e-36; |
| Length | 726 nt |
| Species | Ocimum basilicum |
| Belonged EST Libraries | OB_MEa; |
| Sequence | ATTAAGATTTTATCAAGATGGCGGCTGCTCCCTCTTATTTCATTCACCCCACATCAACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
| EC | 2.6.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816758 |
| Trichome-related Gene from Literature | 816758 |